Your browser is old and dusty. Try Google Chrome!

Details for 6803t03

ORF 6803t03
Accession
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_441061.1_2 Reverse -266 -280 7.9644 0.0955
NP_441061.1_2 Forward -240 -226 1.86788 0.181
NP_441061.1_2 Forward -249 -235 1.27789 0.192
NP_441061.1_2 Reverse -329 -343 -1.37704 0.258
NP_441418.1_6 Reverse -232 -251 -1.37718 0.0136
NP_441418.1_6 Forward -118 -99 -22.3217 0.175
NP_441418.1_6 Reverse -109 -128 -23.9933 0.199
NP_441418.1_6 Forward -121 -102 -29.7948 0.238
NP_441453.1_1 Forward -248 -230 3.65664 0.263
NP_441453.1_4 Reverse -232 -240 6.70593 0.121
NP_442151.1_6 Reverse -271 -285 9.83269 0.139
NP_442151.1_6 Forward -241 -227 5.89945 0.256
NP_441818.1_1 Reverse -266 -277 11.8579 0.155
NP_441818.1_9 Forward -121 -102 7.86593 0.116
NP_441818.1_9 Reverse -232 -251 2.3594 0.189
NP_441818.1_9 Forward -196 -177 -7.17871 0.27
NP_441465.1_5 Forward -177 -163 15.7325 0.286
NP_442287.1_1 Reverse -190 -200 15.3192 0.22
NP_442173.1_1 Forward -240 -232 5.82095 0.2
NP_442752.1_4 Reverse -232 -239 13.8055 0.0199
NP_443027.1_4 Reverse -230 -240 9.32148 0.166
NP_442975.1_10 Forward -245 -231 2.16228 0.283
NP_442975.1_10 Forward -64 -50 1.37564 0.299
NP_440784.1_7 Forward -240 -233 6.23397 0.241
NP_440784.1_7 Reverse -233 -240 6.13563 0.241
NP_440110.1_7 Forward -209 -190 11.5042 0.289
NP_440110.1_8 Forward -216 -197 -0.787193 0.228
NP_442062.1_3 Forward -40 -21 -1.57384 0.26
NP_442062.1_8 Reverse -265 -275 6.56821 0.123
NP_441900.1_2 Forward -257 -239 -3.52148 0.281
NP_441859.1_3 Reverse -231 -250 15.5349 0.0651
NP_441859.1_3 Forward -275 -256 1.76863 0.275
NP_440304.1_4 Forward -282 -272 5.19158 0.223
NP_440304.1_4 Reverse -203 -213 4.99491 0.239
NP_440304.1_4 Forward -123 -113 4.50326 0.261
NP_442242.1_4 Reverse -233 -240 12.4288 0.0393
NP_440044.1_8 Forward -240 -221 -1.27885 0.241
NP_441781.1_7 Reverse -265 -284 4.22769 0.187
NP_440908.1_5 Reverse -336 -353 10.6586 0.238
NP_439918.1_2 Reverse -283 -302 -1.96717 0.24
NP_439918.1_3 Reverse -229 -248 3.73603 0.266
NP_441594.1_6 Reverse -88 -107 1.27776 0.269
NP_440132.1_1 Reverse -230 -248 9.55725 0.234
NP_442896.1_6 Forward -205 -186 17.404 0.161
NP_441925.1_4 Forward -242 -223 -14.3576 0.262
NP_440014.1_3 Reverse -205 -219 15.7779 0.262
NP_441083.1_5 Forward -241 -231 9.81313 0.0224
NP_441083.1_5 Reverse -232 -242 -0.0199663 0.251
NP_442115.2_7 Forward -168 -151 17.5418 0.0673
NP_441738.1_2 Forward -239 -232 15.28 0.0102
NP_440209.1_1 Reverse -232 -240 14.8674 0.012
NP_440209.1_1 Forward -241 -233 5.62429 0.0821
NP_442180.1_2 Forward -174 -155 11.3067 0.123
NP_442889.1_1 Reverse -328 -347 -3.04881 0.145
NP_440056.1_9 Reverse -47 -66 13.5798 0.295
NP_441770.1_4 Reverse -161 -180 -4.32711 0.204
NP_440178.1_7 Forward -242 -223 -21.9284 0.246
NP_442570.1_3 Reverse -279 -298 6.58763 0.151
NP_442570.1_3 Forward -202 -183 1.67108 0.193
NP_442570.1_3 Reverse -263 -282 -7.4737 0.27
NP_440538.1_10 Forward -237 -218 17.109 0.157
NP_441716.1_1 Reverse -232 -246 11.3077 0.0936
NP_441716.1_1 Forward -152 -138 2.75286 0.294
NP_442111.1_4 Forward -135 -121 3.8345 0.229
NP_442111.1_4 Reverse -231 -245 3.53951 0.24
NP_440906.1_5 Forward -240 -233 12.0355 0.0724
NP_440906.1_5 Reverse -233 -240 12.0355 0.0724
NP_440747.1_10 Forward -244 -232 -11.7607 0.142
NP_440747.1_10 Reverse -229 -241 -12.1541 0.227
NP_441265.1_3 Forward -247 -233 6.78443 0.181
NP_440842.1_6 Forward -216 -197 15.0432 0.15
NP_440842.1_10 Reverse -87 -101 1.08123 0.296
NP_441014.1_8 Forward -303 -284 -8.35868 0.283
NP_442848.1_5 Forward -298 -280 2.28076 0.276
NP_442848.1_9 Forward -220 -201 2.75272 0.248
NP_441012.1_4 Forward -284 -271 10.8357 0.26
NP_441012.1_4 Forward -125 -112 6.80412 0.276
NP_441012.1_4 Forward -167 -154 5.62415 0.291
NP_443018.1_3 Forward -240 -233 5.34899 0.212
NP_443018.1_3 Reverse -233 -240 5.34899 0.212
NP_441634.1_8 Reverse -200 -214 5.60446 0.114
NP_440376.1_1 Reverse -205 -214 4.81794 0.149
NP_440376.1_1 Forward -200 -191 1.76968 0.242
NP_440376.1_1 Forward -221 -212 0.884706 0.259
NP_440376.1_1 Reverse -232 -241 -0.000272808 0.285
NP_440376.1_1 Forward -241 -232 -0.0986038 0.285
NP_441857.1_8 Forward -332 -313 12.4875 0.288
NP_441588.1_4 Forward -239 -229 6.37155 0.2
NP_442730.1_8 Reverse -332 -351 7.4718 0.203
NP_442687.1_7 Forward -242 -232 6.07655 0.179
NP_442687.1_7 Forward -344 -334 5.87989 0.183
NP_442687.1_7 Forward -215 -205 5.28991 0.211
NP_442687.1_7 Forward -122 -112 4.20827 0.262
NP_442687.1_7 Reverse -211 -221 3.61828 0.299
NP_442191.1_5 Forward -216 -202 17.0102 0.26
NP_441077.1_6 Forward -36 -20 4.44078 0.255
NP_440066.1_5 Forward -302 -283 5.70185 0.293
NP_441846.1_10 Reverse -149 -168 -16.6185 0.256
NP_441846.1_10 Reverse -144 -163 -23.01 0.275
NP_440781.1_1 Reverse -60 -74 18.6825 0.121
NP_440642.1_1 Forward -212 -193 8.84924 0.239
NP_440642.1_10 Forward -102 -88 6.29216 0.234
NP_440642.1_10 Forward -101 -87 5.01387 0.243
NP_440642.1_10 Reverse -173 -187 2.45727 0.277
NP_440042.1_2 Forward -251 -232 -0.39387 0.229
NP_440667.1_2 Reverse -205 -224 -2.0655 0.232
NP_441950.1_7 Reverse -220 -239 2.65439 0.175
NP_442296.1_5 Forward -192 -173 3.6377 0.251
NP_440360.1_10 Forward -239 -225 4.71948 0.227
NP_442658.1_1 Forward -243 -233 12.1726 0.0615
NP_442658.1_7 Reverse -338 -357 20.1675 0.0841
NP_440141.1_3 Forward -84 -65 2.16274 0.274
NP_440141.1_4 Reverse -223 -242 -10.6203 0.298
NP_440141.1_8 Reverse -81 -100 5.50599 0.273
NP_441855.2_4 Forward -249 -230 22.056 0.00802
NP_442782.1_2 Forward -225 -211 8.94771 0.198
NP_442782.1_2 Forward -375 -361 7.17775 0.205
NP_442782.1_2 Reverse -212 -226 6.58777 0.222
NP_442782.1_2 Reverse -361 -375 4.62115 0.251
NP_442544.1_6 Reverse -60 -79 -4.32711 0.234
NP_442300.1_3 Reverse -204 -223 22.5172 0.00845
NP_442937.1_5 Reverse -227 -246 19.6656 0.019
NP_441958.1_5 Forward -242 -232 0.963343 0.12
NP_441958.1_5 Reverse -231 -241 -6.41148 0.28
NP_441127.1_1 Reverse -373 -387 8.75105 0.288
NP_441127.1_1 Reverse -202 -216 7.9644 0.3
NP_441127.1_5 Forward -228 -209 15.9007 0.274
NP_441754.1_7 Forward -220 -201 15.1424 0.254
NP_440984.1_7 Reverse -200 -214 10.3243 0.126
NP_442911.1_2 Forward -251 -232 -9.44032 0.257
NP_440153.1_5 Forward -220 -206 2.94952 0.219
NP_440153.1_8 Forward -214 -201 -1.55401 0.225
NP_440993.1_3 Forward -251 -232 7.57013 0.141
NP_440993.1_4 Forward -199 -182 2.30045 0.3
NP_442995.1_5 Reverse -227 -246 11.3075 0.211
NP_441099.1_5 Forward -251 -232 0.294447 0.0807
NP_441099.1_5 Forward -266 -247 -10.1286 0.243
NP_442002.1_1 Reverse -215 -233 -6.27403 0.249
NP_441938.1_6 Reverse -130 -149 9.24257 0.206
NP_441646.1_1 Forward -350 -331 -1.08219 0.278
NP_442438.1_10 Reverse -266 -280 -0.295402 0.256
NP_442431.1_10 Reverse -229 -247 6.90232 0.183
NP_442771.1_1 Reverse -230 -248 -6.96235 0.169
NP_442771.1_1 Forward -243 -225 -8.43732 0.193
NP_442771.1_1 Forward -282 -264 -8.53565 0.198
NP_440484.1_1 Reverse -198 -217 11.405 0.203
NP_440147.1_4 Forward -216 -203 0.805932 0.244
NP_441550.1_8 Reverse -230 -240 7.45273 0.159
NP_441550.1_8 Forward -243 -233 7.0594 0.178
NP_441550.1_8 Reverse -210 -220 4.60114 0.299
NP_441916.1_7 Reverse -205 -215 3.22496 0.223
NP_441916.1_7 Forward -121 -111 2.83163 0.239
NP_441916.1_10 Reverse -88 -107 1.86774 0.259
NP_440206.1_4 Reverse -102 -121 -2.16459 0.293
NP_440206.1_9 Forward -299 -280 7.07928 0.293
NP_441041.1_4 Reverse -241 -260 -7.08038 0.181
NP_441041.1_7 Forward -244 -232 12.0821 0.0689
NP_440703.1_9 Reverse -91 -104 12.0151 0.192
NP_441725.1_5 Reverse -272 -282 7.15819 0.103
NP_441725.1_5 Reverse -233 -243 6.96153 0.108
NP_441725.1_5 Forward -240 -230 -0.708283 0.267
NP_441725.1_5 Reverse -113 -123 -0.708283 0.267
NP_439966.1_7 Reverse -230 -240 4.99446 0.248
NP_439966.1_9 Reverse -64 -73 6.98123 0.253
NP_439966.1_9 Reverse -230 -239 0.884706 0.253
NP_442941.1_3 Forward -240 -230 1.25834 0.15
NP_440289.1_2 Forward -244 -231 1.29759 0.132
NP_440983.1_5 Forward -241 -222 5.11266 0.179
NP_440983.1_5 Forward -238 -219 -3.3438 0.237
NP_440260.1_8 Reverse -63 -81 -4.79907 0.273
NP_441678.1_9 Reverse -190 -209 6.09597 0.175
NP_442281.1_1 Forward -80 -66 4.12889 0.206
NP_442281.1_1 Forward -279 -265 1.86729 0.285
NP_001035871.2_7 Forward -203 -193 15.9097 0.14
NP_001035871.2_7 Reverse -214 -224 12.9597 0.237
NP_441087.1_6 Forward -107 -89 -0.76823 0.26
NP_440375.1_8 Reverse -150 -169 2.65439 0.223
NP_440375.1_8 Reverse -186 -205 -0.197208 0.266
NP_441644.1_6 Reverse -232 -242 7.64939 0.121
NP_441644.1_6 Reverse -334 -344 6.46942 0.157
NP_441644.1_6 Forward -241 -231 5.87944 0.174
NP_441644.1_6 Forward -214 -204 5.09279 0.21
NP_440867.1_10 Forward -209 -190 4.03102 0.283
NP_442215.1_2 Reverse -269 -285 -1.51476 0.186
NP_442215.1_2 Reverse -332 -348 -5.25134 0.248
NP_442215.1_2 Forward -108 -92 -7.61128 0.3
NP_442029.1_6 Forward -24 -5 3.44104 0.282
NP_442933.1_10 Reverse -232 -241 5.40793 0.19
NP_441751.2_8 Forward -240 -226 -4.03198 0.158
NP_442926.1_5 Reverse -260 -279 9.59069 0.275
NP_442554.1_8 Forward -240 -230 8.33817 0.0754
NP_442554.1_8 Forward -220 -210 2.14332 0.281
NP_441762.1_7 Forward -76 -64 -4.48425 0.175
NP_441762.1_7 Reverse -231 -243 -5.17256 0.191
NP_441762.1_7 Forward -242 -230 -5.95921 0.258
NP_442142.1_4 Forward -244 -231 16.1449 0.0264
NP_442292.1_1 Forward -240 -231 8.75118 0.0306
NP_441523.1_6 Reverse -92 -111 8.65258 0.188
NP_442406.1_9 Forward -83 -64 -0.39387 0.291
NP_441865.1_3 Forward -382 -364 14.4738 0.241
NP_441865.1_3 Forward -36 -18 13.8838 0.242
NP_440807.1_6 Reverse -282 -301 15.4374 0.267
NP_442301.1_2 Forward -248 -229 12.3883 0.159
NP_441371.1_3 Forward -377 -359 4.83737 0.295
NP_441371.1_3 Forward -148 -130 4.44404 0.295
NP_441715.1_4 Reverse -146 -156 4.79825 0.248
NP_440357.1_3 Reverse -263 -282 0.392778 0.283
NP_440835.1_1 Reverse -81 -100 0.58944 0.102
NP_441198.1_8 Reverse -263 -273 11.3181 0.211
NP_440379.1_5 Reverse -145 -164 -1.37718 0.189
NP_441468.1_1 Forward -240 -233 6.13563 0.209
NP_441468.1_1 Reverse -233 -240 6.0373 0.223
NP_439939.1_1 Forward -302 -283 12.6833 0.275
NP_441020.2_6 Reverse -230 -247 11.6419 0.115
NP_441020.2_6 Forward -120 -103 8.98696 0.182
NP_441015.1_8 Forward -190 -171 2.16274 0.272
NP_441015.1_10 Reverse -221 -240 -3.83545 0.194
NP_441015.1_10 Reverse -200 -219 -4.42544 0.203
NP_441015.1_10 Reverse -230 -249 -9.93197 0.282
NP_441015.1_10 Reverse -227 -246 -10.522 0.284
NP_441673.1_1 Forward -241 -232 1.27803 0.155
NP_441673.1_1 Reverse -232 -241 1.27803 0.155
NP_441673.1_1 Reverse -205 -214 -7.86675 0.187
NP_441673.1_1 Forward -214 -205 -7.96508 0.206
NP_441876.1_9 Forward -58 -48 12.0743 0.267
NP_441826.1_2 Reverse -67 -81 2.16287 0.134
NP_441826.1_2 Forward -247 -233 0.491246 0.184
NP_441637.1_9 Reverse -366 -384 10.8356 0.177
NP_442490.1_9 Forward -220 -201 -7.57203 0.278
NP_441764.1_8 Reverse -360 -370 10.7365 0.3
NP_442868.1_6 Reverse -230 -240 7.64985 0.0726
NP_442868.1_6 Forward -243 -233 6.76487 0.101
NP_442719.1_2 Reverse -367 -385 -4.01314 0.206
NP_441612.1_2 Reverse -131 -141 6.61303 0.283
NP_442559.1_3 Forward -306 -287 16.7157 0.133
NP_442559.1_3 Forward -58 -39 14.7491 0.14
NP_442227.1_2 Forward -248 -229 -1.67217 0.264
NP_442808.1_1 Forward -242 -232 7.84605 0.0668
NP_442808.1_1 Forward -298 -288 3.91283 0.218
NP_442808.1_1 Forward -52 -42 2.33954 0.27
NP_442820.1_3 Reverse -83 -93 12.5659 0.289
NP_442542.1_2 Forward -243 -230 6.4108 0.227
NP_442542.1_9 Reverse -198 -212 9.24208 0.138
NP_442113.1_10 Forward -173 -154 -7.76869 0.271
NP_442342.1_9 Forward -235 -219 4.97508 0.241
NP_441114.1_3 Reverse -336 -345 7.37455 0.239
NP_440558.1_2 Reverse -262 -281 -2.0655 0.222
NP_440558.1_2 Reverse -87 -106 -6.09707 0.271
NP_440558.1_2 Forward -203 -184 -7.27704 0.291
NP_441498.1_2 Forward -245 -226 14.0608 0.121
NP_441518.1_10 Forward -227 -209 13.3914 0.292
NP_441878.1_6 Forward -215 -205 0.865012 0.132
NP_441878.1_6 Forward -242 -232 0.668351 0.139
NP_441878.1_6 Reverse -204 -214 -6.90313 0.198
NP_441878.1_6 Forward -344 -334 -7.49312 0.231
NP_441878.1_6 Forward -281 -271 -7.49312 0.231
NP_441878.1_6 Forward -122 -112 -7.98478 0.285
NP_441557.1_5 Reverse -232 -241 0.983037 0.0911
NP_441557.1_5 Forward -241 -232 0.688044 0.128
NP_441445.1_1 Reverse -223 -242 7.7676 0.126
NP_441433.1_2 Forward -238 -219 13.7658 0.265
NP_441433.1_8 Reverse -288 -307 6.68596 0.174
NP_441914.1_2 Reverse -182 -200 16.3421 0.188
NP_440101.1_10 Reverse -226 -245 4.52268 0.208
NP_442183.1_1 Reverse -232 -246 7.37441 0.143
NP_442183.1_9 Reverse -157 -167 9.12481 0.296
NP_442397.1_9 Reverse -265 -284 5.80098 0.246
NP_440356.1_10 Forward -248 -230 10.7372 0.253
NP_442135.1_3 Reverse -197 -216 3.93269 0.281
NP_441574.1_1 Forward -121 -102 13.5691 0.0793
NP_441574.1_1 Reverse -220 -239 7.47261 0.11
NP_442347.1_2 Forward -139 -130 6.29291 0.175
NP_442347.1_2 Forward -240 -231 3.93297 0.284
NP_442645.1_2 Forward -202 -183 -10.3253 0.144
NP_442645.1_2 Reverse -263 -282 -18.5851 0.276
NP_440547.1_1 Forward -123 -104 7.07848 0.294
NP_441037.1_4 Reverse -230 -240 8.48718 0.237
NP_440151.1_10 Reverse -212 -231 21.8289 0.0688
NP_441633.1_3 Reverse -230 -243 -6.37223 0.248
NP_440136.1_2 Forward -240 -233 6.23397 0.171
NP_440136.1_2 Reverse -233 -240 6.13563 0.193
NP_442590.1_10 Reverse -205 -224 4.81767 0.27
NP_442590.1_10 Reverse -328 -347 3.53937 0.29
NP_442998.1_5 Forward -178 -168 11.8781 0.176
NP_442998.1_10 Forward -239 -232 15.5754 0.0102
NP_440299.1_1 Forward -245 -232 6.50855 0.139
NP_440299.1_1 Forward -125 -112 2.37867 0.291
NP_441799.1_1 Reverse -208 -222 4.42388 0.25
NP_441007.1_10 Reverse -200 -213 9.45906 0.0939
NP_441007.1_10 Reverse -227 -240 8.37742 0.115
NP_442334.1_2 Forward -290 -273 -7.33598 0.289
NP_442201.1_10 Reverse -134 -153 -14.7502 0.288
NP_440256.1_1 Forward -125 -106 -4.03212 0.145
NP_440256.1_1 Reverse -213 -232 -6.49039 0.213
NP_440256.1_1 Forward -172 -153 -7.96535 0.248
NP_441090.1_2 Forward -162 -143 1.86774 0.231
NP_441559.1_8 Forward -205 -191 -7.37523 0.291
NP_440915.1_6 Reverse -228 -242 0.88457 0.151
NP_440915.1_6 Forward -225 -211 -3.24533 0.292
NP_441296.1_9 Forward -169 -156 14.67 0.18
NP_442785.1_7 Reverse -286 -300 10.6193 0.228
NP_442785.1_7 Forward -223 -209 10.0294 0.231
NP_442069.1_6 Forward -301 -282 12.8808 0.11
NP_442866.1_1 Reverse -107 -126 -2.26216 0.21
NP_440748.1_2 Forward -152 -133 20.0605 0.0834
NP_442150.1_8 Reverse -367 -386 17.0817 0.222
NP_441199.1_6 Forward -245 -226 9.53756 0.0859
NP_441199.1_6 Forward -206 -187 -1.08219 0.285
NP_439985.1_7 Reverse -143 -162 4.81767 0.224
NP_442386.1_9 Forward -275 -266 5.30919 0.257
NP_440570.1_5 Reverse -192 -211 8.16093 0.174
NP_441750.1_1 Reverse -226 -245 -3.93378 0.204
NP_441340.1_5 Reverse -233 -240 6.13563 0.175
NP_441340.1_5 Forward -240 -233 5.93897 0.198
NP_441776.1_5 Forward -284 -265 10.0292 0.291
NP_440211.1_4 Reverse -372 -382 13.8447 0.29
NP_440586.1_1 Reverse -222 -241 3.73603 0.202
NP_440586.1_1 Forward -125 -106 -0.000545616 0.237
NP_440586.1_8 Reverse -233 -240 11.4451 0.0645
NP_442251.1_6 Forward -240 -233 12.0355 0.0627
NP_442251.1_8 Forward -58 -44 17.4042 0.212
NP_442959.1_4 Forward -370 -351 4.62101 0.27
NP_440684.1_9 Reverse -226 -240 8.16106 0.235
NP_441262.1_3 Reverse -232 -239 14.7888 0.0223
NP_440027.1_3 Reverse -90 -108 4.63995 0.255
NP_443051.1_1 Reverse -231 -240 0.786375 0.125
NP_443051.1_1 Forward -242 -233 -1.08191 0.281
NP_439996.1_6 Reverse -231 -250 9.07943 0.242
NP_439984.1_3 Reverse -225 -239 13.372 0.223
NP_439937.1_8 Reverse -230 -249 -3.14714 0.265
NP_441657.1_5 Forward -204 -185 11.7992 0.101
NP_440408.1_7 Reverse -131 -150 10.4225 0.247
NP_440408.1_7 Reverse -143 -162 8.75091 0.269
NP_440372.1_2 Reverse -233 -240 6.72562 0.0929
NP_440372.1_2 Forward -240 -233 6.62729 0.151
NP_441181.1_6 Reverse -233 -251 7.00065 0.219
NP_441789.1_7 Forward -227 -208 -3.14789 0.268
NP_440819.1_5 Reverse -359 -367 7.98423 0.228
NP_440819.1_5 Forward -179 -171 7.68924 0.266
NP_440316.1_10 Reverse -89 -99 8.4365 0.239
NP_440316.1_10 Reverse -159 -169 6.27322 0.264
NP_441803.1_2 Forward -342 -323 -0.39387 0.275
NP_440589.1_4 Reverse -200 -219 14.8474 0.204
NP_441572.1_7 Forward -286 -267 4.12936 0.104
NP_441572.1_7 Forward -227 -208 -5.60541 0.265
NP_442384.1_10 Forward -221 -208 1.49425 0.257
NP_442114.1_4 Forward -241 -230 8.02348 0.227
NP_441877.1_7 Reverse -194 -213 1.08032 0.244
NP_440344.1_10 Forward -248 -231 4.56207 0.0245
NP_440531.1_6 Forward -208 -189 -2.45882 0.252
NP_440531.1_6 Reverse -197 -216 -3.24547 0.264
NP_440531.1_6 Reverse -177 -196 -4.32711 0.279
NP_440531.1_8 Reverse -145 -164 8.25926 0.216
NP_440189.1_10 Forward -225 -206 4.71934 0.279
NP_440826.1_5 Reverse -131 -149 13.834 0.262
NP_441965.1_3 Forward -162 -143 0.294447 0.238
NP_440297.1_9 Reverse -272 -282 7.05986 0.15
NP_440297.1_9 Reverse -113 -123 0.176696 0.282
NP_440350.1_1 Forward -371 -352 9.3409 0.12
NP_442187.1_3 Reverse -231 -241 16.893 0.0619
NP_442280.1_10 Forward -168 -150 8.57124 0.258
NP_442280.1_10 Reverse -342 -360 6.13623 0.28
NP_440298.1_6 Reverse -218 -232 17.0102 0.251
NP_440894.1_10 Forward -111 -92 2.3594 0.29
NP_440999.1_9 Forward -245 -231 3.24451 0.133
NP_440999.1_9 Forward -215 -201 -2.26202 0.264
NP_440888.1_2 Forward -140 -126 8.65209 0.152
NP_440888.1_2 Reverse -265 -279 8.06211 0.172
NP_440888.1_2 Forward -241 -227 6.39049 0.236
NP_442147.1_2 Reverse -197 -216 8.65258 0.295
NP_442147.1_6 Reverse -210 -224 18.4851 0.182
NP_441759.1_2 Forward -177 -158 -0.295539 0.259
NP_442512.1_4 Reverse -244 -262 14.3755 0.278
NP_441543.1_2 Forward -240 -231 7.17789 0.131
NP_442845.1_2 Reverse -226 -240 7.57108 0.195
NP_442845.1_2 Forward -280 -266 7.07942 0.199
NP_441551.1_5 Reverse -208 -224 7.03934 0.249
NP_441918.1_7 Reverse -156 -175 -3.3438 0.297
NP_443064.1_6 Reverse -131 -141 10.7247 0.136
NP_443064.1_6 Forward -241 -231 8.39772 0.292
NP_442337.1_8 Reverse -276 -295 9.53756 0.169
NP_442578.1_7 Reverse -233 -240 5.93897 0.183
NP_441462.1_2 Reverse -232 -242 8.4365 0.0363
NP_441462.1_2 Reverse -205 -215 -0.511621 0.236
NP_441462.1_2 Forward -214 -204 -0.511621 0.236
NP_441621.1_7 Reverse -230 -244 -1.47537 0.18
NP_441621.1_7 Forward -243 -229 -4.7203 0.242
NP_443062.1_1 Forward -241 -223 4.54812 0.258
NP_440519.1_6 Forward -104 -90 13.2743 0.29
NP_440519.1_8 Reverse -232 -248 3.10679 0.253
NP_440519.1_8 Forward -121 -105 2.12349 0.269
NP_442204.1_1 Forward -125 -114 1.4353 0.271
NP_442204.1_1 Reverse -156 -167 1.14031 0.28
NP_442204.1_9 Forward -131 -113 16.3535 0.25
NP_440516.1_6 Forward -99 -85 10.0287 0.233
NP_440516.1_8 Reverse -232 -241 17.6993 0.00442
NP_442428.1_5 Forward -240 -233 6.13563 0.209
NP_442428.1_5 Reverse -233 -240 6.0373 0.212
NP_441032.1_5 Forward -250 -231 14.8474 0.146
NP_440783.1_3 Forward -234 -215 1.37609 0.266
NP_441443.1_7 Reverse -229 -248 1.27776 0.227
NP_441443.1_10 Reverse -273 -291 1.19838 0.284
NP_442120.1_10 Forward -274 -255 -7.08038 0.217
NP_442120.1_10 Forward -121 -102 -9.24366 0.242
NP_442823.1_8 Reverse -191 -210 10.2259 0.297
NP_441867.1_2 Reverse -81 -100 -20.65 0.292
NP_440673.1_3 Forward -239 -232 12.4288 0.0426
NP_440673.1_3 Reverse -114 -121 8.8889 0.206
NP_440865.1_9 Reverse -226 -245 7.27595 0.0657
NP_441052.1_2 Forward -241 -231 10.7964 0.0285
NP_442219.1_8 Reverse -222 -241 9.9065 0.219
NP_442219.1_9 Forward -240 -231 8.06287 0.0696
NP_440436.1_4 Forward -240 -231 13.9623 0.0193
NP_441884.1_9 Reverse -229 -248 -12.9802 0.138
NP_441884.1_9 Reverse -144 -163 -20.7484 0.205
NP_441884.1_9 Forward -217 -198 -23.2067 0.284
NP_442412.1_5 Forward -196 -177 3.53937 0.294
NP_440314.1_9 Forward -240 -221 -0.688862 0.113
NP_442907.1_9 Forward -174 -155 -6.68705 0.289
NP_441719.1_4 Reverse -233 -240 6.72562 0.093
NP_441719.1_4 Forward -240 -233 6.62729 0.151
NP_441733.1_10 Reverse -229 -242 8.18076 0.14
NP_441004.1_1 Reverse -226 -245 -2.36049 0.144
NP_441004.1_1 Reverse -232 -251 -14.1602 0.265
NP_441004.1_1 Forward -199 -180 -16.4218 0.284
NP_441004.1_5 Forward -197 -183 11.406 0.241
NP_439949.1_7 Reverse -371 -385 14.5526 0.225
NP_441034.1_6 Reverse -22 -41 14.7491 0.261
NP_442873.1_3 Forward -393 -374 11.995 0.169
NP_442873.1_3 Forward -251 -232 7.57013 0.209
NP_443054.1_2 Forward -276 -262 8.06273 0.13
NP_441851.1_10 Forward -275 -265 3.91327 0.296
NP_441668.1_4 Reverse -146 -165 -0.197208 0.249
NP_442515.1_1 Forward -242 -228 1.67122 0.152
NP_440593.1_9 Reverse -199 -213 12.0943 0.24
NP_440940.1_7 Forward -251 -233 9.6548 0.159
NP_441409.1_6 Forward -247 -228 -7.4737 0.151
NP_442843.1_1 Reverse -241 -260 -9.73531 0.269
NP_439960.1_10 Reverse -195 -213 1.78911 0.191
NP_441124.1_5 Forward -314 -304 11.3848 0.257
NP_440195.1_4 Forward -91 -72 3.93269 0.297
NP_442006.1_2 Reverse -232 -249 -15.3008 0.221
NP_442006.1_2 Reverse -211 -228 -15.3008 0.221
NP_442006.1_3 Reverse -226 -244 1.78911 0.238
NP_442243.1_1 Reverse -199 -217 -2.04653 0.286
NP_441570.1_1 Reverse -232 -250 -8.04399 0.101
NP_441078.1_4 Reverse -232 -241 0.0980582 0.205
NP_441078.1_4 Forward -241 -232 0.0980582 0.205
NP_441078.1_4 Reverse -205 -214 -1.57357 0.266
NP_442729.1_5 Reverse -89 -99 15.2213 0.199
NP_442729.1_5 Reverse -231 -241 8.1415 0.248
NP_440526.1_3 Forward -240 -229 7.92465 0.126
NP_440526.1_3 Reverse -233 -244 7.62965 0.139
NP_441432.1_8 Reverse -231 -240 7.17789 0.102
NP_441432.1_8 Forward -275 -266 5.40793 0.158
NP_441432.1_8 Reverse -265 -274 2.65466 0.292
NP_443024.1_3 Reverse -263 -273 10.2065 0.289
NP_442320.1_8 Reverse -226 -240 5.40779 0.0386
NP_442344.1_7 Forward -240 -221 1.57275 0.074
NP_441732.1_2 Forward -245 -229 -16.1661 0.165
NP_441030.1_9 Forward -95 -78 11.7402 0.259
NP_442540.1_4 Reverse -124 -138 18.4858 0.281
NP_440760.1_1 Forward -241 -222 -23.2067 0.288
NP_442797.1_1 Reverse -102 -121 -2.45882 0.255
NP_442797.1_7 Reverse -183 -201 1.98577 0.245
NP_442797.1_7 Forward -242 -224 0.609134 0.272
NP_441057.1_3 Reverse -337 -356 -13.7669 0.299
NP_441057.1_4 Reverse -231 -249 18.3087 0.0572
NP_442178.1_1 Reverse -176 -195 14.2574 0.152
NP_440913.1_1 Reverse -230 -248 17.4237 0.0951
NP_442489.1_7 Forward -241 -232 0.786375 0.152
NP_442489.1_7 Reverse -232 -241 0.589713 0.17
NP_442489.1_7 Reverse -205 -214 -1.08191 0.179
NP_440559.1_1 Forward -240 -231 14.1594 0.0317
NP_442763.1_10 Reverse -266 -285 1.47442 0.282
NP_441659.2_8 Reverse -232 -242 6.46988 0.0744
NP_441659.2_8 Forward -214 -204 6.46988 0.0744
NP_440860.1_8 Forward -332 -313 13.5691 0.296
NP_441022.1_1 Forward -373 -364 15.0954 0.183
NP_442008.1_2 Reverse -209 -228 5.30933 0.226
NP_441800.1_7 Forward -240 -222 6.11567 0.167
NP_441800.1_7 Reverse -104 -122 -3.6191 0.279
NP_440779.1_5 Reverse -232 -249 -14.3175 0.244
NP_442346.1_5 Forward -122 -112 11.4848 0.0663
NP_442346.1_5 Forward -281 -271 8.73149 0.128
NP_442346.1_5 Reverse -231 -241 6.8632 0.188
NP_442346.1_5 Forward -242 -232 4.40493 0.29
NP_440545.1_3 Forward -218 -201 2.20212 0.106
NP_440545.1_3 Reverse -228 -245 -2.41943 0.184
NP_440545.1_3 Forward -125 -108 -4.68105 0.23
NP_440545.1_3 Reverse -108 -125 -5.56602 0.253
NP_440831.1_3 Reverse -223 -242 10.5615 0.175
NP_440486.1_6 Reverse -83 -102 6.78429 0.278
NP_440459.1_2 Forward -223 -206 10.2653 0.204
NP_440459.1_2 Reverse -151 -168 7.70866 0.283
NP_441653.1_2 Reverse -254 -273 5.17239 0.248
NP_440010.1_3 Reverse -193 -212 -8.55534 0.297
NP_440010.1_4 Forward -251 -232 4.71854 0.22
NP_440010.1_10 Reverse -220 -239 1.37609 0.3
NP_442027.1_5 Reverse -210 -229 10.4225 0.283
NP_442551.1_4 Reverse -263 -278 -2.77337 0.276
NP_442311.1_5 Forward -196 -177 2.26107 0.251
NP_442603.1_7 Reverse -232 -246 7.47213 0.205
NP_441585.1_5 Forward -128 -109 6.58682 0.211
NP_441948.1_4 Forward -224 -206 -5.48739 0.268
NP_441047.1_2 Forward -193 -174 -2.55715 0.281
NP_441833.1_4 Forward -240 -233 14.1004 0.0258
NP_441833.1_4 Reverse -233 -240 6.13563 0.198
NP_442162.1_9 Forward -240 -233 6.62729 0.142
NP_442162.1_9 Reverse -233 -240 6.52896 0.178
NP_442796.1_9 Forward -191 -172 16.5191 0.0856
NP_440671.1_4 Forward -127 -113 5.21113 0.289
NP_442073.1_6 Forward -250 -231 0.687771 0.25
NP_442140.1_3 Reverse -233 -243 15.123 0.0433
NP_442140.1_3 Forward -74 -64 6.56821 0.162
NP_442140.1_3 Forward -240 -230 4.10993 0.261
NP_442021.1_3 Reverse -226 -245 -5.01543 0.251
NP_441671.1_10 Forward -361 -342 8.16093 0.205
NP_441813.1_5 Forward -243 -233 -0.609952 0.261
NP_441813.1_7 Forward -235 -221 11.307 0.225
NP_440590.1_4 Forward -240 -227 6.80412 0.0565
NP_440567.1_1 Reverse -233 -247 6.19444 0.0871
NP_442839.1_10 Forward -92 -78 14.2576 0.288
NP_442497.1_10 Reverse -233 -242 0.983037 0.123
NP_442497.1_10 Forward -240 -231 0.688044 0.141
NP_440821.1_4 Reverse -230 -240 8.1415 0.055
NP_440821.1_4 Forward -243 -233 7.45319 0.0708
NP_441239.1_9 Forward -243 -231 4.95553 0.234
NP_442897.1_7 Reverse -47 -66 15.2408 0.228
NP_441727.1_3 Forward -248 -229 6.09597 0.246
NP_440400.1_1 Forward -242 -223 4.52188 0.22
NP_440400.1_1 Forward -250 -231 -1.27961 0.285
NP_440400.1_1 Reverse -103 -122 -2.75457 0.287
NP_441892.1_1 Forward -250 -233 -1.82945 0.214
NP_441892.1_1 Reverse -256 -273 -4.28772 0.258
NP_440604.1_6 Reverse -232 -251 4.71934 0.122
NP_442044.1_9 Reverse -232 -251 1.27776 0.297
NP_442193.1_3 Forward -199 -180 14.9218 0.295
NP_442193.1_3 Reverse -186 -205 14.3434 0.299
NP_441508.1_4 Reverse -190 -204 13.285 0.297
NP_441698.1_7 Reverse -45 -63 19.9803 0.0758
NP_442052.1_8 Forward -216 -206 12.5664 0.265
NP_441782.1_10 Reverse -380 -394 15.3688 0.23
NP_440546.1_4 Reverse -232 -242 11.9852 0.0679
NP_443033.1_3 Reverse -205 -224 9.83255 0.268
NP_442041.1_5 Reverse -107 -126 7.96426 0.191
NP_441230.1_5 Reverse -143 -162 3.14605 0.205
NP_441230.1_5 Reverse -260 -279 0.392778 0.269
NP_441230.1_5 Reverse -107 -126 -0.885524 0.292
NP_442592.1_1 Forward -202 -183 11.1109 0.202
NP_442499.1_1 Forward -240 -221 2.26107 0.289
NP_441249.1_8 Reverse -154 -173 5.211 0.247
NP_442479.1_9 Reverse -374 -393 -0.688862 0.21
NP_442479.1_9 Forward -202 -183 -9.34199 0.266
NP_442402.1_1 Forward -377 -358 13.1758 0.203
NP_442402.1_4 Reverse -338 -357 3.9319 0.147
NP_442402.1_4 Reverse -380 -399 -1.96793 0.195
NP_442402.1_6 Reverse -48 -57 13.1761 0.289
NP_442402.1_9 Reverse -284 -303 9.83255 0.275
NP_442402.1_10 Forward -59 -49 14.0409 0.182
NP_442402.1_10 Forward -253 -243 12.8609 0.204
NP_442402.1_10 Forward -369 -359 10.8943 0.275
NP_441848.1_7 Forward -311 -292 0.785326 0.228
NP_440696.1_3 Forward -109 -91 2.28076 0.216
NP_440696.1_3 Reverse -277 -295 -2.93078 0.28
NP_442039.1_7 Reverse -187 -197 15.713 0.211
NP_442039.1_7 Forward -73 -63 13.648 0.211
NP_441811.1_1 Reverse -175 -194 3.83436 0.299
NP_442837.1_3 Forward -240 -233 6.13563 0.25
NP_442837.1_3 Reverse -233 -240 5.93897 0.265
NP_442053.1_1 Reverse -232 -241 7.76787 0.0895
NP_442053.1_1 Forward -241 -232 7.17789 0.104
NP_440505.1_3 Reverse -230 -240 15.3197 0.0131
NP_441701.1_3 Forward -284 -267 8.29864 0.247
NP_440914.1_1 Forward -241 -231 13.4947 0.0297
NP_442533.1_6 Forward -214 -205 5.50626 0.14
NP_442533.1_6 Forward -274 -265 4.91628 0.165
NP_442533.1_6 Reverse -205 -214 4.22796 0.186
NP_442533.1_6 Reverse -212 -221 3.24465 0.219
NP_442533.1_6 Reverse -334 -343 2.75299 0.241
NP_441089.1_10 Forward -232 -213 3.73603 0.276
NP_441482.1_7 Forward -127 -113 -1.96703 0.0913
NP_441482.1_7 Forward -247 -233 -10.6202 0.211
NP_439944.1_9 Forward -240 -230 9.41981 0.1
NP_439944.1_9 Reverse -233 -243 6.46988 0.179
NP_441028.1_5 Forward -329 -317 12.822 0.244
NP_441028.1_6 Forward -139 -129 12.6642 0.183
NP_441028.1_6 Reverse -171 -181 12.0743 0.192
NP_441028.1_6 Forward -59 -49 3.8145 0.281
NP_441028.1_6 Forward -368 -358 3.51951 0.292
NP_440116.1_5 Reverse -229 -246 4.26707 0.209
NP_441527.1_4 Reverse -309 -328 -9.88384 0.262
NP_440115.1_6 Reverse -229 -239 9.7148 0.115
NP_440007.1_9 Forward -284 -270 11.7993 0.163
NP_440007.1_9 Forward -203 -189 9.14437 0.171
NP_442492.1_2 Reverse -232 -251 1.67108 0.224
NP_441059.1_2 Reverse -213 -232 -6.58872 0.268
NP_441961.1_4 Reverse -263 -282 2.85105 0.281
NP_441602.1_3 Reverse -227 -246 -4.13045 0.261
NP_441106.1_1 Reverse -204 -213 3.14632 0.243
NP_439903.1_6 Forward -203 -184 1.08032 0.255
NP_439903.1_6 Forward -374 -355 0.981987 0.255
NP_441286.1_1 Reverse -231 -243 20.6885 0.00225
NP_441286.1_1 Reverse -270 -282 -6.74586 0.278
NP_441286.1_1 Forward -242 -230 -6.74586 0.278
NP_440670.1_8 Forward -241 -232 6.8829 0.0907
NP_441930.1_2 Reverse -148 -158 15.0247 0.19
NP_440886.1_7 Forward -212 -202 5.19112 0.194
NP_442614.1_2 Reverse -131 -145 10.3243 0.234
NP_442614.1_2 Reverse -90 -104 7.86607 0.262
NP_442800.1_7 Forward -195 -176 1.67108 0.296
NP_441753.1_10 Reverse -103 -122 2.45773 0.234
NP_441753.1_10 Reverse -140 -159 0.294447 0.296
NP_441808.1_8 Reverse -232 -251 9.14423 0.259
NP_442264.1_2 Reverse -222 -239 9.28195 0.198
NP_441021.1_1 Reverse -266 -285 -8.65367 0.199
NP_441463.1_3 Reverse -222 -241 -10.522 0.296
NP_441626.1_2 Forward -240 -233 6.0373 0.212
NP_441626.1_2 Reverse -233 -240 6.0373 0.212
NP_442794.1_1 Forward -245 -233 3.2839 0.286
NP_442794.1_1 Forward -284 -272 2.89058 0.286
NP_442615.1_1 Reverse -223 -241 3.26407 0.0561
NP_441962.1_4 Reverse -227 -246 -10.1286 0.224
NP_441962.1_4 Forward -255 -236 -13.6686 0.277
NP_441962.1_4 Forward -246 -227 -14.1602 0.284
NP_440855.1_1 Reverse -190 -209 3.24438 0.188
NP_441836.1_2 Forward -217 -198 -2.55715 0.23
NP_440634.1_6 Reverse -190 -204 18.7808 0.0941
NP_441993.1_1 Reverse -226 -245 9.54836 0.135
NP_442352.1_8 Forward -57 -43 15.2402 0.273
NP_440114.1_5 Reverse -102 -121 10.7175 0.213
NP_440114.1_10 Reverse -66 -80 8.16106 0.213
NP_441425.1_4 Reverse -21 -35 13.8643 0.282
NP_440766.1_5 Forward -399 -387 7.46481 0.29
NP_439988.1_3 Reverse -283 -297 9.5377 0.247
NP_439988.1_3 Forward -103 -89 3.73617 0.298
NP_441237.1_9 Reverse -233 -243 12.8614 0.102
NP_441237.1_9 Forward -240 -230 10.5998 0.224
NP_442867.1_8 Reverse -177 -196 5.80098 0.275
NP_442867.1_8 Reverse -280 -299 3.73603 0.297
NP_440457.1_1 Reverse -156 -168 5.74217 0.138
NP_440457.1_1 Forward -125 -113 -1.04266 0.289
NP_441801.1_4 Forward -58 -48 2.83163 0.231
NP_440801.1_8 Forward -242 -223 6.88262 0.166
NP_440801.1_8 Forward -392 -373 1.27776 0.246
NP_441984.1_3 Forward -354 -336 7.59063 0.245
NP_442509.1_9 Reverse -232 -242 6.27276 0.279
NP_442582.1_3 Reverse -303 -317 12.3301 0.289
NP_442784.1_3 Forward -199 -180 14.0608 0.264
NP_441496.1_3 Reverse -370 -389 12.1917 0.295
NP_440554.1_4 Reverse -213 -223 4.69992 0.181
NP_442862.1_3 Forward -370 -353 6.23369 0.267
NP_441885.1_5 Forward -241 -231 1.35667 0.11
NP_440649.2_5 Reverse -231 -250 15.9291 0.217
NP_441614.1_5 Reverse -224 -243 25.0739 0.00382
NP_442341.1_7 Reverse -333 -347 5.89945 0.142
NP_441756.1_5 Forward -245 -226 -3.93378 0.29
NP_441173.1_9 Forward -197 -189 13.2937 0.17
NP_441173.1_9 Reverse -379 -387 12.9004 0.206
NP_441173.1_9 Forward -58 -50 12.0154 0.214
NP_441173.1_9 Forward -367 -359 9.75379 0.284
NP_440423.1_6 Reverse -224 -243 -20.2567 0.252
NP_443000.1_7 Reverse -230 -240 0.57002 0.294
NP_443059.1_10 Forward -249 -230 17.8948 0.0934
NP_440727.1_2 Forward -282 -263 1.67108 0.288
NP_440275.1_3 Forward -243 -233 8.04317 0.0602
NP_440275.1_3 Reverse -230 -240 8.04317 0.0602
NP_440091.1_1 Reverse -228 -240 -0.846001 0.293
NP_440679.1_10 Forward -116 -97 -12.1936 0.19
NP_442451.1_2 Forward -282 -263 -7.17871 0.232
NP_441207.1_7 Reverse -300 -314 8.67452 0.282
NP_439962.1_4 Reverse -208 -227 -2.85214 0.241
NP_439962.1_4 Forward -249 -230 -8.85033 0.298
NP_440149.1_10 Reverse -132 -151 -10.7186 0.285
NP_442373.1_2 Reverse -217 -236 -11.3086 0.293
NP_440216.1_1 Reverse -212 -226 -6.39192 0.143
NP_440216.1_1 Forward -221 -207 -11.2101 0.169
NP_440216.1_1 Reverse -205 -219 -12.1934 0.247
NP_440216.1_9 Forward -53 -44 11.4061 0.267
NP_440216.1_9 Reverse -12 -21 6.29291 0.289
NP_440172.1_1 Reverse -232 -242 7.45319 0.0789
NP_440172.1_1 Forward -274 -264 3.32329 0.232
NP_442371.1_1 Reverse -49 -59 12.4676 0.249
NP_441226.1_7 Reverse -213 -220 8.29857 0.205
NP_441111.1_7 Forward -240 -232 8.96754 0.0463
NP_442379.1_10 Reverse -225 -242 -3.10775 0.248
NP_441766.1_2 Forward -241 -232 8.65285 0.0495
NP_440416.1_9 Forward -228 -209 -14.3569 0.176
NP_440416.1_9 Reverse -264 -283 -18.2901 0.256
NP_443052.1_9 Forward -260 -241 3.93269 0.159
NP_440072.1_5 Reverse -226 -244 -4.30741 0.299
NP_441019.1_9 Forward -110 -91 17.6982 0.181
NP_442154.1_1 Reverse -233 -251 -4.8974 0.125
NP_442154.1_1 Reverse -218 -236 -7.65067 0.146
NP_442154.1_1 Forward -120 -102 -8.53565 0.168
NP_442564.1_9 Forward -280 -266 13.5421 0.285
NP_442564.1_10 Forward -100 -86 17.7975 0.165
NP_440261.1_5 Forward -220 -207 -5.97891 0.192
NP_440261.1_5 Reverse -233 -246 -10.8955 0.221
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

ATGGGACACAACCTTGGTTAAATCCGCCAAAAGTTTTCCCCGGCTGAGCAAAACATGGGTAATGGGCAGCACTAATTCCTGTTGTATTTTTAAATTTTCCGCCGCCCAAAGGCAGTCCAGGGTAATGGCAATGCCTCCTTCCGTCGAATTCTCCACCGGCACGATCGCCACATCCACCAAGCGTTGGGCCGCCGCCTCCAGGGTTTTGCCAATGCTGGGACAGGGAAAAAACTCCACCGCCTGCCCAGTGCGCTCCTGATGCTGTTCCCCATAAACCAGGGCGACGGTTTCCGTGTTGGTTCCCCTTGGCCCCAAATGTGCAACGACCAATGGCGGCATAAATTCTCCCCAGGAAAGCTGGTACAGAAAATGTTATCATTTTGCAGTGGAATTAGGTTGC

CDS

No sequence available

Protein

No sequence available