Your browser is old and dusty. Try Google Chrome!

Details for 6803t02

ORF 6803t02
Accession
Symbol
Category
Definition
Regulatory function No
External resources CyanoBase, KEGG, NCBI

Promoter profile

Table filtering
Motif Direction Start Stop Central FIMO score FIMO q-value
NP_440795.1_7 Forward -129 -122 14.6904 0.0123
NP_440795.1_7 Reverse -122 -129 14.6904 0.0123
NP_441418.1_6 Reverse -162 -181 -21.24 0.143
NP_441418.1_6 Reverse -367 -386 -21.9284 0.163
NP_441418.1_6 Forward -130 -111 -28.5165 0.205
NP_442291.1_5 Reverse -120 -136 -0.531451 0.185
NP_440897.1_6 Forward -130 -111 6.88182 0.0893
NP_440897.1_6 Reverse -121 -140 -1.37794 0.188
NP_441453.1_1 Reverse -114 -132 7.88485 0.209
NP_441453.1_3 Forward -234 -216 19.587 0.109
NP_441453.1_4 Reverse -121 -129 16.539 0.00633
NP_441453.1_4 Forward -130 -122 16.539 0.00633
NP_441453.1_7 Forward -291 -284 11.9372 0.298
NP_441453.1_7 Reverse -259 -266 11.9372 0.298
NP_441623.1_1 Reverse -360 -378 -2.93078 0.25
NP_442151.1_6 Reverse -121 -135 12.9793 0.0628
NP_442151.1_6 Forward -376 -362 12.3893 0.0749
NP_441818.1_1 Reverse -122 -133 15.4961 0.0264
NP_440226.1_1 Reverse -121 -140 12.8808 0.0399
NP_441465.1_8 Forward -48 -30 9.85225 0.196
NP_440120.1_4 Forward -237 -223 15.3392 0.273
NP_441519.1_4 Forward -375 -358 15.8701 0.153
NP_442655.1_2 Reverse -179 -198 1.57275 0.288
NP_442173.1_1 Forward -129 -121 15.4574 0.00633
NP_442173.1_1 Reverse -122 -130 15.4574 0.00633
NP_442752.1_4 Forward -130 -123 13.8055 0.0199
NP_442752.1_4 Reverse -121 -128 13.8055 0.0199
NP_443027.1_4 Reverse -119 -129 11.8781 0.0872
NP_443027.1_4 Forward -132 -122 11.0914 0.107
NP_442975.1_10 Reverse -117 -131 12.782 0.0459
NP_440784.1_7 Forward -129 -122 15.9687 0.0123
NP_440784.1_7 Reverse -122 -129 15.9687 0.0123
NP_441250.1_3 Reverse -6 -25 6.68596 0.22
NP_440061.1_9 Reverse -119 -133 18.3868 0.00917
NP_440061.1_9 Forward -132 -118 11.2087 0.116
NP_441054.1_4 Forward -140 -122 8.47561 0.0835
NP_439979.1_2 Forward -367 -348 14.8474 0.142
NP_439979.1_2 Forward -364 -345 7.47261 0.266
NP_439979.1_7 Reverse -351 -368 17.0501 0.215
NP_442062.1_3 Reverse -6 -25 6.58763 0.179
NP_442062.1_8 Forward -130 -120 19.4496 0.000558
NP_442062.1_8 Reverse -121 -131 17.3846 0.00193
NP_442062.1_8 Reverse -45 -55 3.02829 0.289
NP_440761.1_4 Reverse -178 -197 -3.83545 0.132
NP_440304.1_4 Forward -56 -46 3.71661 0.293
NP_440304.1_4 Forward -132 -122 1.84832 0.299
NP_440304.1_4 Reverse -119 -129 1.84832 0.299
NP_442242.1_4 Forward -129 -122 14.3954 0.0124
NP_442242.1_4 Reverse -122 -129 14.3954 0.0124
NP_440044.1_8 Forward -375 -356 -3.63879 0.288
NP_442602.1_3 Reverse -35 -54 0.786102 0.197
NP_441208.1_9 Forward -174 -160 6.09611 0.253
NP_441594.1_6 Reverse -146 -165 5.01433 0.211
NP_441594.1_6 Forward -397 -378 4.32602 0.221
NP_442110.1_7 Reverse -121 -135 2.06454 0.222
NP_441925.1_4 Reverse -339 -358 -16.1275 0.281
NP_441925.1_4 Forward -151 -132 -17.3075 0.293
NP_440856.1_7 Forward -376 -357 7.86593 0.12
NP_441083.1_5 Reverse -121 -131 20.3345 0.00053
NP_441083.1_5 Reverse -162 -172 11.6814 0.0159
NP_441083.1_5 Forward -130 -120 11.3864 0.0159
NP_442827.1_8 Reverse -359 -378 3.63691 0.144
NP_441738.1_2 Forward -128 -121 15.28 0.0102
NP_441738.1_2 Reverse -123 -130 15.28 0.0102
NP_441558.1_5 Forward -132 -113 18.9773 0.0104
NP_440209.1_1 Reverse -121 -129 18.1123 0.00295
NP_440209.1_1 Forward -130 -122 18.1123 0.00295
NP_442889.1_8 Reverse -118 -132 13.6669 0.0588
NP_441713.1_1 Reverse -115 -134 -17.0118 0.292
NP_441713.1_5 Reverse -363 -382 7.07928 0.262
NP_440178.1_7 Reverse -120 -139 -22.2233 0.258
NP_442570.1_3 Reverse -160 -179 -8.65367 0.291
NP_442570.1_3 Reverse -67 -86 -9.047 0.296
NP_441716.1_1 Forward -130 -116 3.93283 0.259
NP_441716.1_1 Reverse -121 -135 3.93283 0.259
NP_442111.1_4 Forward -131 -117 20.9441 0.00257
NP_442111.1_4 Reverse -120 -134 4.22782 0.216
NP_441624.1_7 Forward -321 -307 10.4227 0.217
NP_441163.1_1 Reverse -337 -354 4.0697 0.294
NP_440481.1_5 Forward -222 -203 16.8141 0.201
NP_440906.1_5 Forward -129 -122 15.8704 0.0124
NP_440906.1_5 Reverse -122 -129 15.8704 0.0124
NP_440747.1_10 Forward -133 -121 16.7552 0.0019
NP_440747.1_10 Reverse -118 -130 7.21714 0.00643
NP_440747.1_10 Forward -57 -45 -12.1541 0.227
NP_441130.1_10 Reverse -119 -133 9.43936 0.125
NP_441130.1_10 Forward -132 -118 7.27608 0.164
NP_441486.1_1 Reverse -118 -132 -3.83532 0.183
NP_441486.1_1 Forward -133 -119 -4.13031 0.189
NP_440403.1_4 Reverse -153 -172 -7.08038 0.237
NP_440842.1_10 Forward -200 -186 3.8345 0.254
NP_441014.1_5 Forward -278 -260 11.2289 0.261
NP_441014.1_10 Forward -131 -112 -0.29631 0.249
NP_442848.1_4 Reverse -187 -201 16.5192 0.196
NP_442848.1_5 Forward -198 -180 -2.63579 0.286
NP_441012.1_4 Reverse -30 -43 17.5222 0.117
NP_441012.1_4 Forward -195 -182 10.639 0.262
NP_443018.1_3 Forward -129 -122 14.8871 0.0123
NP_443018.1_3 Reverse -122 -129 14.8871 0.0123
NP_441634.1_1 Forward -183 -164 -3.83545 0.277
NP_441634.1_8 Forward -132 -118 6.58777 0.114
NP_441634.1_8 Reverse -26 -40 3.24451 0.154
NP_441634.1_8 Forward -396 -382 -0.0987402 0.247
NP_440376.1_1 Forward -130 -121 19.4693 0.000692
NP_440376.1_1 Reverse -121 -130 19.4693 0.000692
NP_440376.1_1 Reverse -189 -198 0.786375 0.26
NP_441588.1_4 Reverse -123 -133 6.46988 0.193
NP_442687.1_7 Reverse -120 -130 15.8113 0.0125
NP_442687.1_7 Forward -131 -121 8.92815 0.0994
NP_442687.1_7 Forward -377 -367 3.61828 0.299
NP_441846.1_10 Forward -369 -350 -13.2752 0.201
NP_442958.1_3 Reverse -110 -129 6.4893 0.188
NP_441422.1_7 Reverse -359 -376 -0.354483 0.167
NP_440691.1_10 Forward -202 -183 8.45592 0.269
NP_440667.1_2 Forward -363 -344 1.47442 0.204
NP_442658.1_1 Reverse -119 -129 17.0891 0.00615
NP_442658.1_1 Forward -132 -122 7.94438 0.199
NP_442198.1_3 Forward -139 -120 6.4893 0.251
NP_442782.1_2 Reverse -185 -199 -0.000409212 0.297
NP_442544.1_2 Reverse -359 -373 9.73436 0.089
NP_441414.1_9 Reverse -121 -140 5.211 0.048
NP_441414.1_9 Forward -130 -111 2.26107 0.0685
NP_443061.1_10 Reverse -146 -165 15.9291 0.275
NP_441487.1_9 Reverse -120 -139 -2.95047 0.298
NP_441256.1_2 Forward -366 -347 4.22769 0.299
NP_442321.1_4 Reverse -36 -55 -5.80207 0.284
NP_441958.1_5 Forward -131 -121 12.2714 0.00183
NP_441958.1_5 Reverse -120 -130 12.2714 0.00183
NP_442486.1_6 Forward -382 -363 2.26107 0.266
NP_442605.1_4 Forward -127 -108 8.45592 0.299
NP_440203.1_5 Forward -373 -363 12.6642 0.141
NP_439905.1_1 Reverse -122 -135 8.9674 0.227
NP_439905.1_1 Forward -129 -116 8.37742 0.234
NP_439905.1_1 Forward -375 -362 6.4108 0.288
NP_440984.1_7 Forward -135 -121 11.6026 0.122
NP_440984.1_7 Reverse -148 -162 4.62115 0.296
NP_441097.1_2 Forward -265 -248 5.54538 0.259
NP_439990.1_5 Reverse -116 -129 13.589 0.0935
NP_439990.1_5 Forward -135 -122 13.4906 0.0942
NP_442911.1_2 Forward -140 -121 11.6025 0.0131
NP_442911.1_2 Reverse -111 -130 7.57094 0.0243
NP_440153.1_5 Reverse -122 -136 2.75286 0.219
NP_442119.1_9 Forward -131 -112 11.1109 0.248
NP_442064.1_1 Reverse -64 -83 -10.9153 0.259
NP_442064.1_4 Reverse -65 -84 5.60352 0.267
NP_443055.1_6 Reverse -20 -38 -1.55487 0.28
NP_441099.1_5 Reverse -111 -130 8.25926 0.0387
NP_441099.1_5 Forward -140 -121 0.294447 0.0807
NP_441099.1_5 Forward -181 -162 -0.885524 0.1
NP_441099.1_5 Forward -82 -63 -4.72043 0.147
NP_442002.1_9 Reverse -120 -127 10.7572 0.185
NP_441294.1_7 Reverse -117 -131 9.4426 0.244
NP_442438.1_10 Forward -135 -121 0.0979218 0.239
NP_441000.1_6 Forward -172 -158 2.5562 0.136
NP_441000.1_6 Forward -131 -117 -2.45868 0.216
NP_441000.1_6 Reverse -120 -134 -3.93365 0.225
NP_440147.1_4 Reverse -119 -132 17.6205 0.00602
NP_440147.1_4 Forward -132 -119 15.0639 0.0197
NP_441175.1_7 Reverse -121 -140 13.5691 0.113
NP_441295.1_4 Reverse -40 -59 -1.86883 0.29
NP_441295.1_4 Forward -135 -116 -2.85214 0.29
NP_441550.1_8 Forward -132 -122 15.1225 0.0132
NP_441550.1_8 Reverse -119 -129 8.82935 0.112
NP_441916.1_7 Forward -130 -120 18.4663 0.00144
NP_441916.1_7 Reverse -121 -131 10.3048 0.0261
NP_441041.1_4 Forward -130 -111 -8.16202 0.197
NP_441041.1_7 Reverse -159 -171 10.4301 0.0982
NP_441041.1_7 Reverse -118 -130 8.48655 0.135
NP_440569.1_10 Forward -219 -200 4.05798 0.276
NP_441725.1_4 Forward -135 -121 3.14559 0.279
NP_441725.1_4 Reverse -116 -130 3.14559 0.279
NP_441725.1_5 Forward -129 -119 2.04498 0.115
NP_441725.1_5 Reverse -122 -132 2.04498 0.115
NP_439966.1_7 Reverse -119 -129 17.9741 0.00631
NP_439966.1_7 Forward -132 -122 15.3192 0.0152
NP_439966.1_9 Reverse -119 -128 0.884706 0.253
NP_442941.1_3 Reverse -122 -132 19.2529 0.00262
NP_442941.1_3 Forward -129 -119 10.7964 0.0116
NP_440289.1_2 Reverse -118 -131 11.1307 0.0212
NP_440289.1_2 Reverse -159 -172 1.10092 0.137
NP_440289.1_2 Forward -133 -120 -3.61896 0.267
NP_440983.1_5 Forward -203 -184 -7.37537 0.288
NP_442281.1_1 Forward -59 -45 11.7987 0.0437
NP_442281.1_1 Forward -135 -121 7.76712 0.0927
NP_442281.1_1 Forward -176 -162 7.47213 0.0993
NP_442281.1_1 Reverse -116 -130 2.5556 0.263
NP_442281.1_5 Reverse -165 -184 14.3549 0.288
NP_442256.1_2 Reverse -119 -137 -7.84733 0.215
NP_442500.1_4 Reverse -1 -20 20.5506 0.0675
NP_441556.1_7 Forward -188 -169 -1.37794 0.3
NP_442982.1_5 Forward -202 -183 9.3409 0.12
NP_441644.1_6 Reverse -121 -131 17.3841 0.00127
NP_441644.1_6 Forward -130 -120 10.1076 0.0628
NP_441644.1_6 Reverse -361 -371 7.64939 0.121
NP_441644.1_6 Reverse -312 -322 7.55106 0.123
NP_441644.1_6 Forward -37 -27 7.15773 0.133
NP_441644.1_6 Forward -321 -311 4.10949 0.249
NP_442215.1_2 Reverse -119 -135 -0.728113 0.171
NP_442215.1_2 Reverse -160 -176 -4.26803 0.23
NP_442029.1_6 Forward -135 -116 11.8975 0.155
NP_440253.1_2 Forward -130 -112 17.2271 0.0115
NP_440253.1_2 Reverse -121 -139 9.36059 0.0491
NP_440929.1_8 Forward -130 -121 19.2726 0.000701
NP_440929.1_8 Reverse -121 -130 19.2726 0.000701
NP_440469.1_6 Reverse -331 -350 19.1731 0.111
NP_440566.1_2 Forward -374 -355 5.211 0.287
NP_442933.1_10 Forward -130 -121 17.601 0.00325
NP_442933.1_10 Reverse -121 -130 17.601 0.00325
NP_442926.1_3 Reverse -301 -320 3.6377 0.279
NP_442554.1_8 Reverse -122 -132 16.2046 0.0065
NP_442554.1_8 Forward -129 -119 14.1397 0.0144
NP_442554.1_8 Forward -320 -310 5.38824 0.15
NP_442554.1_8 Reverse -46 -56 2.14332 0.281
NP_442554.1_8 Reverse -29 -39 1.94665 0.288
NP_441762.1_7 Forward -131 -119 2.98891 0.0676
NP_441762.1_7 Reverse -120 -132 2.39892 0.0676
NP_442142.1_4 Forward -324 -311 13.6867 0.0348
NP_442142.1_4 Forward -133 -120 6.80355 0.154
NP_442142.1_4 Reverse -118 -131 5.91857 0.178
NP_442142.1_4 Forward -379 -366 2.96866 0.269
NP_442292.1_1 Reverse -122 -131 18.486 0.00229
NP_442292.1_1 Forward -129 -120 9.63616 0.0183
NP_442476.1_6 Reverse -122 -136 11.996 0.0525
NP_442476.1_6 Forward -129 -115 4.52282 0.143
NP_439989.1_10 Forward -182 -163 14.3549 0.284
NP_443009.1_5 Forward -131 -120 18.3477 0.00265
NP_443009.1_5 Reverse -277 -288 4.48308 0.244
NP_442406.1_9 Forward -54 -35 -0.000545616 0.291
NP_440947.1_1 Forward -302 -283 6.4893 0.152
NP_441715.1_4 Forward -129 -119 18.8596 0.00741
NP_441715.1_4 Reverse -122 -132 17.3846 0.0106
NP_440183.1_9 Reverse -30 -49 -21.0434 0.296
NP_441468.1_1 Forward -129 -122 15.8704 0.0124
NP_441468.1_1 Reverse -122 -129 15.8704 0.0124
NP_441020.2_6 Reverse -180 -197 9.57695 0.168
NP_441015.1_10 Forward -375 -356 -4.81876 0.212
NP_441673.1_1 Forward -130 -121 20.8459 0.000698
NP_441673.1_1 Reverse -121 -130 20.8459 0.000698
NP_441826.1_2 Forward -382 -368 3.53951 0.109
NP_441826.1_2 Forward -136 -122 -1.47537 0.248
NP_441826.1_5 Forward -375 -356 0.58944 0.3
NP_441330.1_1 Forward -135 -116 -1.96717 0.0791
NP_442868.1_6 Forward -132 -122 19.2529 0.00563
NP_442868.1_6 Reverse -119 -129 10.3048 0.038
NP_442719.1_2 Reverse -215 -233 -4.40646 0.211
NP_441612.1_2 Reverse -121 -131 8.54929 0.21
NP_442808.1_1 Reverse -120 -130 18.4657 0.00201
NP_442808.1_1 Forward -131 -121 8.63269 0.0481
NP_440145.1_3 Forward -140 -121 1.86774 0.122
NP_442820.1_5 Reverse -300 -319 11.4058 0.228
NP_442542.1_2 Reverse -119 -132 15.6539 0.0793
NP_442542.1_2 Forward -56 -43 5.62415 0.257
NP_442050.1_5 Forward -132 -122 14.3359 0.0206
NP_442050.1_5 Reverse -119 -129 6.96107 0.27
NP_440601.1_4 Reverse -240 -259 14.0608 0.291
NP_440558.1_2 Reverse -363 -382 -5.80207 0.264
NP_441878.1_6 Forward -131 -121 10.4031 0.0176
NP_441878.1_6 Reverse -120 -130 10.4031 0.0176
NP_441878.1_6 Forward -55 -45 2.24165 0.0462
NP_441878.1_6 Reverse -44 -54 1.25834 0.108
NP_441878.1_6 Reverse -264 -274 0.0783647 0.152
NP_441036.1_8 Reverse -120 -130 17.7779 0.000554
NP_441036.1_8 Forward -131 -121 8.33817 0.174
NP_441534.1_5 Forward -217 -198 1.47442 0.293
NP_441557.1_5 Forward -130 -121 19.9609 0.000699
NP_441557.1_5 Reverse -121 -130 19.9609 0.000699
NP_441557.1_8 Forward -245 -235 14.9258 0.183
NP_441520.1_9 Forward -190 -171 19.8623 0.0535
NP_442066.2_9 Reverse -117 -130 10.8357 0.154
NP_442066.2_9 Forward -134 -121 10.5407 0.154
NP_441433.1_8 Reverse -260 -279 -3.44213 0.283
NP_442777.1_3 Reverse -251 -269 7.68819 0.195
NP_442419.1_2 Forward -135 -116 -5.21209 0.295
NP_441655.1_10 Reverse -41 -59 10.3439 0.154
NP_442347.1_2 Reverse -122 -131 12.4878 0.056
NP_442347.1_2 Forward -129 -120 11.1111 0.056
NP_442347.1_2 Forward -89 -80 3.83464 0.284
NP_442645.1_2 Forward -138 -119 -2.45882 0.0487
NP_442645.1_2 Reverse -181 -200 -14.7502 0.18
NP_441037.1_4 Reverse -119 -129 6.92787 0.237
NP_442594.1_8 Forward -312 -293 3.53937 0.28
NP_442047.1_2 Forward -176 -162 17.3058 0.161
NP_441633.1_3 Forward -132 -119 10.8357 0.0286
NP_441633.1_3 Reverse -119 -132 5.72248 0.0481
NP_440136.1_2 Forward -129 -122 15.9687 0.0123
NP_440136.1_2 Reverse -122 -129 15.9687 0.0123
NP_442998.1_5 Reverse -270 -280 7.94484 0.278
NP_442998.1_10 Forward -128 -121 15.5754 0.0102
NP_442998.1_10 Reverse -123 -130 15.5754 0.0102
NP_440299.1_1 Forward -134 -121 20.6681 0.00128
NP_440299.1_1 Reverse -117 -130 18.5049 0.00393
NP_441799.1_1 Forward -134 -120 7.27547 0.147
NP_441799.1_1 Reverse -117 -131 3.44058 0.298
NP_440640.1_6 Forward -375 -356 13.8641 0.119
NP_442802.1_5 Forward -165 -146 16.7157 0.123
NP_441007.1_10 Forward -135 -122 -0.964025 0.296
NP_442201.1_10 Reverse -110 -129 -6.78538 0.184
NP_442333.2_5 Forward -182 -163 -10.6203 0.246
NP_440256.1_1 Forward -133 -114 1.37609 0.0761
NP_440256.1_1 Forward -373 -354 -5.40875 0.182
NP_440256.1_1 Reverse -118 -137 -6.58872 0.215
NP_440087.1_1 Reverse -153 -172 -8.85033 0.285
NP_441090.1_6 Forward -274 -260 7.66941 0.284
NP_441559.1_8 Reverse -116 -130 12.8809 0.0574
NP_441559.1_8 Reverse -105 -119 0.0979218 0.17
NP_441559.1_8 Forward -135 -121 -5.90027 0.271
NP_440915.1_6 Reverse -117 -131 12.1926 0.0218
NP_440915.1_6 Forward -134 -120 10.3243 0.0322
NP_440915.1_6 Reverse -158 -172 -0.885388 0.212
NP_440717.1_1 Forward -375 -356 13.4708 0.159
NP_442785.1_7 Forward -200 -186 10.816 0.228
NP_440026.1_4 Reverse -71 -90 9.0459 0.259
NP_441939.1_3 Forward -129 -110 5.211 0.284
NP_441199.1_6 Forward -196 -177 -1.57384 0.295
NP_440677.1_6 Reverse -262 -281 9.63589 0.27
NP_442386.1_9 Reverse -120 -129 15.7322 0.0144
NP_442386.1_9 Forward -131 -122 13.8639 0.0289
NP_441750.1_1 Forward -375 -356 -11.3086 0.3
NP_441340.1_5 Forward -129 -122 15.6737 0.0124
NP_441340.1_5 Reverse -122 -129 15.6737 0.0124
NP_442484.1_2 Forward -141 -122 8.16093 0.144
NP_440327.1_6 Reverse -177 -196 2.45773 0.296
NP_441132.1_3 Forward -160 -141 2.16274 0.294
NP_442240.1_2 Reverse -122 -141 -19.5684 0.295
NP_440586.1_8 Forward -129 -122 13.2151 0.026
NP_440586.1_8 Reverse -122 -129 13.2151 0.026
NP_440586.1_8 Forward -36 -29 5.8403 0.283
NP_440586.1_8 Reverse -313 -320 5.8403 0.283
NP_442251.1_6 Forward -129 -122 15.2804 0.0124
NP_442251.1_6 Reverse -122 -129 15.2804 0.0124
NP_442959.1_7 Reverse -359 -378 0.392778 0.235
NP_441262.1_3 Reverse -121 -128 14.7888 0.0223
NP_441262.1_3 Forward -130 -123 14.7888 0.0223
NP_440027.1_3 Forward -376 -358 10.8348 0.164
NP_440027.1_8 Reverse -118 -137 4.71854 0.287
NP_443051.1_1 Reverse -120 -129 10.4228 0.00754
NP_443051.1_1 Forward -131 -122 10.4228 0.00754
NP_439937.1_9 Forward -131 -114 -8.61494 0.176
NP_440626.1_8 Forward -395 -376 8.06259 0.267
NP_440439.1_1 Reverse -118 -131 2.96921 0.122
NP_440439.1_1 Forward -133 -120 1.88757 0.139
NP_439943.1_7 Forward -215 -196 3.53937 0.29
NP_440372.1_2 Forward -129 -122 16.3621 0.0124
NP_440372.1_2 Reverse -122 -129 16.3621 0.0124
NP_442722.1_6 Forward -189 -170 20.6317 0.0734
NP_440316.1_10 Reverse -311 -321 7.45319 0.251
NP_439977.1_5 Reverse -115 -134 12.9791 0.0531
NP_439977.1_6 Reverse -296 -314 16.0471 0.271
NP_440139.1_1 Reverse -176 -195 3.83357 0.197
NP_440139.1_1 Reverse -156 -175 2.35861 0.235
NP_442384.1_10 Reverse -121 -134 21.1604 0.00194
NP_442384.1_10 Forward -130 -117 19.4888 0.00338
NP_442114.1_4 Forward -130 -119 9.20345 0.17
NP_440364.1_10 Reverse -38 -57 19.174 0.203
NP_440221.1_8 Reverse -46 -65 20.7473 0.0747
NP_441018.1_7 Forward -307 -288 6.98095 0.278
NP_442262.1_10 Forward -129 -122 14.1988 0.0123
NP_442262.1_10 Reverse -122 -129 14.1988 0.0123
NP_441689.1_5 Forward -132 -122 5.78111 0.197
NP_440163.1_10 Forward -40 -30 9.61647 0.229
NP_440344.1_10 Reverse -114 -131 3.67709 0.0263
NP_440344.1_10 Forward -383 -366 -13.7275 0.293
NP_440075.1_2 Forward -373 -354 2.45773 0.292
NP_440531.1_6 Forward -186 -167 3.44104 0.145
NP_441965.1_10 Reverse -118 -134 2.51681 0.287
NP_440297.1_8 Reverse -264 -282 10.4422 0.278
NP_440297.1_9 Forward -53 -43 0.471689 0.282
NP_440297.1_9 Forward -129 -119 -0.118297 0.282
NP_440297.1_9 Reverse -122 -132 -0.118297 0.282
NP_440297.1_9 Reverse -29 -39 -0.41329 0.283
NP_440350.1_1 Reverse -370 -389 -4.13045 0.24
NP_440350.1_5 Reverse -217 -236 -7.27704 0.299
NP_441896.1_3 Reverse -112 -131 6.68596 0.1
NP_441896.1_3 Forward -139 -120 -3.04881 0.294
NP_441896.1_5 Reverse -381 -388 15.3787 0.268
NP_441103.1_9 Forward -160 -150 12.6848 0.29
NP_440999.1_9 Reverse -117 -131 12.0943 0.0414
NP_440888.1_2 Reverse -121 -135 20.4518 0.000632
NP_440888.1_2 Forward -130 -116 17.8952 0.00302
NP_440888.1_2 Forward -376 -362 14.4536 0.0176
NP_440888.1_2 Forward -171 -157 6.29216 0.241
NP_440052.1_5 Reverse -110 -129 2.16274 0.165
NP_442033.1_10 Reverse -119 -138 -1.37718 0.138
NP_441543.1_2 Forward -129 -120 18.486 0.00236
NP_441543.1_2 Reverse -122 -131 16.9127 0.00359
NP_442845.1_2 Forward -136 -122 6.19444 0.215
NP_441469.1_8 Reverse -120 -129 16.126 0.00797
NP_441469.1_8 Forward -131 -122 6.48957 0.227
NP_443064.1_6 Reverse -121 -131 12.5669 0.0796
NP_442337.1_1 Forward -330 -311 8.35759 0.259
NP_441306.1_7 Reverse -146 -165 20.4523 0.0762
NP_442578.1_7 Forward -129 -122 14.5921 0.026
NP_442578.1_7 Reverse -122 -129 14.5921 0.026
NP_442286.1_8 Forward -300 -282 14.0311 0.294
NP_441462.1_2 Forward -130 -120 11.5831 0.00406
NP_441462.1_2 Reverse -121 -131 11.5831 0.00406
NP_441462.1_2 Reverse -162 -172 -1.19994 0.291
NP_443062.1_1 Forward -130 -112 4.93815 0.244
NP_443062.1_1 Reverse -121 -139 4.2556 0.268
NP_443062.1_6 Reverse -113 -132 0.392778 0.295
NP_441601.1_4 Forward -377 -358 -3.73712 0.293
NP_441601.1_4 Reverse -348 -367 -4.72043 0.293
NP_442204.1_1 Reverse -308 -319 2.51695 0.266
NP_442204.1_1 Forward -134 -123 2.12362 0.266
NP_442204.1_1 Reverse -117 -128 2.12362 0.266
NP_442487.1_5 Reverse -110 -129 3.44025 0.284
NP_440516.1_2 Reverse -115 -133 4.14905 0.139
NP_440516.1_2 Reverse -336 -354 -2.63579 0.299
NP_440516.1_8 Forward -130 -121 16.9127 0.00442
NP_440516.1_8 Reverse -121 -130 16.9127 0.00442
NP_442428.1_5 Forward -129 -122 15.8704 0.0124
NP_442428.1_5 Reverse -122 -129 15.8704 0.0124
NP_440783.1_5 Forward -369 -350 -6.1954 0.29
NP_440673.1_3 Forward -128 -121 12.4288 0.0426
NP_440673.1_3 Reverse -123 -130 12.4288 0.0426
NP_440673.1_3 Forward -374 -367 6.72562 0.277
NP_441052.1_2 Reverse -121 -131 19.9412 0.00106
NP_441052.1_2 Forward -130 -120 10.5014 0.0285
NP_441052.1_2 Forward -376 -366 5.5849 0.111
NP_442219.1_9 Reverse -122 -131 17.7976 0.00718
NP_442219.1_9 Forward -129 -120 8.35786 0.0681
NP_440436.1_4 Forward -129 -120 18.1905 0.00233
NP_440436.1_4 Reverse -122 -131 17.2072 0.00233
NP_441884.1_9 Forward -379 -360 -14.8485 0.138
NP_441884.1_9 Forward -333 -314 -16.3235 0.138
NP_441884.1_9 Reverse -118 -137 -23.2067 0.284
NP_440314.1_9 Reverse -122 -141 6.88262 0.0534
NP_440314.1_9 Forward -129 -110 -9.14533 0.26
NP_442414.1_8 Reverse -228 -247 6.39097 0.293
NP_441719.1_4 Forward -129 -122 16.3621 0.0124
NP_441719.1_4 Reverse -122 -129 16.3621 0.0124
NP_441733.1_10 Forward -133 -120 7.09911 0.156
NP_441004.1_1 Forward -136 -117 -12.3902 0.247
NP_441004.1_2 Reverse -35 -54 -3.83545 0.285
NP_441004.1_4 Forward -200 -190 16.2046 0.154
NP_440296.1_6 Reverse -11 -29 13.5618 0.292
NP_442206.1_1 Forward -55 -36 -2.45882 0.153
NP_442206.1_10 Reverse -361 -376 1.2582 0.236
NP_443054.1_2 Forward -173 -159 1.67122 0.245
NP_443054.1_2 Forward -132 -118 1.17956 0.251
NP_441851.1_10 Reverse -120 -130 16.008 0.00552
NP_441851.1_10 Forward -131 -121 15.8113 0.00552
NP_442001.1_4 Forward -206 -187 10.2251 0.264
NP_442001.1_4 Reverse -292 -311 6.78348 0.29
NP_442515.1_1 Forward -131 -117 4.71948 0.107
NP_442515.1_1 Reverse -120 -134 2.65453 0.131
NP_442515.1_1 Reverse -320 -334 -4.81863 0.298
NP_440593.1_3 Forward -135 -116 -2.75381 0.228
NP_441409.1_6 Forward -327 -308 -5.40875 0.103
NP_442314.1_1 Forward -48 -30 -5.29072 0.272
NP_440432.1_9 Reverse -122 -137 3.22482 0.0967
NP_440432.1_9 Forward -129 -114 -4.93665 0.228
NP_439960.1_10 Forward -137 -119 3.75572 0.163
NP_439960.1_10 Reverse -357 -375 -1.25915 0.242
NP_440431.1_3 Reverse -44 -63 -11.2103 0.284
NP_440195.1_4 Forward -84 -65 4.42435 0.295
NP_442006.1_2 Forward -178 -161 -15.6941 0.228
NP_442006.1_2 Reverse -358 -375 -16.2841 0.247
NP_442006.1_2 Reverse -169 -186 -16.7758 0.264
NP_441003.1_9 Reverse -297 -316 4.916 0.274
NP_442243.1_1 Forward -136 -118 -2.24319 0.288
NP_441570.1_1 Forward -376 -358 -13.5505 0.223
NP_441078.1_4 Forward -130 -121 19.6659 0.0007
NP_441078.1_4 Reverse -121 -130 19.6659 0.0007
NP_441078.1_4 Forward -54 -45 -1.47524 0.266
NP_442729.1_5 Reverse -311 -321 9.41981 0.235
NP_442729.1_8 Forward -134 -121 9.36073 0.125
NP_442729.1_8 Reverse -117 -130 9.06573 0.125
NP_440526.1_3 Reverse -122 -133 1.04151 0.267
NP_441432.1_8 Forward -131 -122 16.8143 0.00595
NP_441432.1_8 Reverse -366 -375 11.9961 0.0519
NP_441432.1_8 Reverse -120 -129 8.25953 0.0755
NP_441432.1_9 Forward -113 -100 9.76185 0.267
NP_442320.1_8 Forward -136 -122 13.7659 0.0144
NP_442320.1_8 Reverse -115 -129 7.76774 0.0186
NP_441732.1_2 Reverse -117 -133 -15.3794 0.145
NP_441030.1_6 Reverse -299 -318 12.3701 0.245
NP_442003.1_9 Reverse -183 -202 7.66927 0.235
NP_440760.1_1 Reverse -121 -140 6.09597 0.0115
NP_440760.1_1 Forward -130 -111 -20.0601 0.22
NP_442797.1_7 Reverse -120 -138 -1.55415 0.299
NP_440199.1_10 Forward -40 -30 12.0747 0.138
NP_441057.1_4 Reverse -179 -197 11.5239 0.14
NP_442353.1_4 Reverse -115 -134 5.60352 0.183
NP_440913.1_1 Reverse -365 -383 6.80398 0.221
NP_442751.1_8 Reverse -349 -367 19.292 0.173
NP_442489.1_7 Forward -130 -121 20.1576 0.000695
NP_442489.1_7 Reverse -121 -130 20.1576 0.000695
NP_442489.1_7 Forward -54 -45 -1.6719 0.235
NP_442489.1_7 Reverse -45 -54 -1.96689 0.28
NP_441452.1_1 Reverse -349 -368 18.289 0.117
NP_440559.1_1 Reverse -122 -131 17.4043 0.00658
NP_440559.1_1 Forward -129 -120 8.75118 0.0586
NP_441659.2_8 Reverse -121 -131 18.1713 0.00133
NP_441659.2_8 Forward -130 -120 11.9764 0.0147
NP_441659.2_8 Forward -37 -27 -0.314959 0.298
NP_439956.1_7 Forward -292 -273 2.94938 0.265
NP_439956.1_7 Reverse -233 -252 2.0644 0.276
NP_441800.1_7 Reverse -352 -370 -0.570838 0.228
NP_441807.1_5 Forward -141 -122 15.3391 0.11
NP_442776.1_1 Forward -273 -254 4.32602 0.278
NP_442346.1_5 Forward -131 -121 16.6963 0.00248
NP_442346.1_5 Reverse -120 -130 9.02648 0.118
NP_442346.1_5 Forward -55 -45 4.79825 0.272
NP_442346.1_5 Reverse -311 -321 4.50326 0.286
NP_442346.1_5 Forward -38 -28 4.40493 0.29
NP_442346.1_10 Reverse -365 -384 10.6192 0.117
NP_440545.1_3 Forward -134 -117 -4.38605 0.224
NP_441856.1_3 Reverse -118 -137 -0.885524 0.228
NP_441856.1_3 Forward -133 -114 -3.24547 0.279
NP_440486.1_9 Reverse -261 -275 15.7325 0.193
NP_440459.1_2 Reverse -119 -136 15.4768 0.113
NP_440459.1_2 Reverse -297 -314 8.88863 0.246
NP_440847.1_3 Reverse -351 -365 11.4053 0.263
NP_442603.1_7 Reverse -121 -135 20.7467 0.00695
NP_442603.1_7 Forward -130 -116 10.6187 0.125
NP_442603.1_7 Reverse -162 -176 7.76712 0.195
NP_442603.1_7 Reverse -252 -266 5.99717 0.264
NP_441888.1_7 Reverse -116 -130 12.8809 0.0743
NP_441888.1_7 Forward -135 -121 3.04785 0.225
NP_441833.1_4 Forward -129 -122 15.9687 0.0124
NP_441833.1_4 Reverse -122 -129 15.9687 0.0124
NP_441895.1_10 Forward -228 -209 -18.5851 0.282
NP_442162.1_9 Forward -129 -122 16.2637 0.0124
NP_442162.1_9 Reverse -122 -129 16.2637 0.0124
NP_442199.1_5 Reverse -304 -323 0.786102 0.167
NP_442140.1_3 Forward -129 -119 14.238 0.0486
NP_442140.1_3 Reverse -122 -132 10.3048 0.0902
NP_442140.1_3 Forward -36 -26 4.99491 0.232
NP_440875.1_9 Forward -319 -309 12.6548 0.106
NP_440875.1_9 Forward -128 -118 8.46937 0.233
NP_441813.1_5 Reverse -119 -129 19.4496 0.00647
NP_441813.1_5 Forward -132 -122 18.1713 0.00743
NP_442254.1_1 Reverse -226 -245 -4.42544 0.282
NP_440590.1_4 Forward -129 -116 22.1438 0.00377
NP_440590.1_4 Reverse -122 -135 19.4888 0.00651
NP_440567.1_1 Reverse -122 -136 7.17775 0.0764
NP_440567.1_1 Forward -129 -115 0.491246 0.244
NP_442497.1_10 Forward -129 -120 10.4228 0.0087
NP_442497.1_10 Reverse -122 -131 10.4228 0.0087
NP_440821.1_4 Reverse -119 -129 10.2065 0.0163
NP_440821.1_4 Forward -132 -122 9.41981 0.0286
NP_441239.1_9 Reverse -119 -131 14.1986 0.0288
NP_441239.1_9 Forward -132 -120 7.80712 0.148
NP_441239.1_9 Forward -56 -44 3.97222 0.269
NP_441892.1_1 Reverse -358 -375 -5.46769 0.281
NP_440665.1_1 Reverse -225 -244 -14.4552 0.262
NP_442105.1_9 Reverse -291 -305 13.7693 0.294
NP_442270.1_9 Reverse -356 -375 2.55606 0.14
NP_441017.1_6 Reverse -117 -131 11.9953 0.232
NP_441017.1_6 Forward -134 -120 11.307 0.273
NP_440900.1_4 Forward -319 -300 15.651 0.271
NP_440354.1_7 Forward -136 -118 6.90232 0.278
NP_441617.1_2 Reverse -288 -307 18.0924 0.135
NP_442138.1_10 Forward -171 -152 -7.57203 0.29
NP_440412.1_2 Reverse -182 -201 8.35759 0.281
NP_440546.1_4 Forward -130 -120 11.8882 0.0679
NP_440546.1_4 Reverse -312 -322 10.4338 0.109
NP_440546.1_4 Reverse -121 -131 10.046 0.109
NP_441230.1_5 Reverse -356 -375 -0.885524 0.292
NP_440462.1_6 Reverse -119 -129 17.2863 0.00752
NP_440462.1_6 Forward -132 -122 9.61647 0.0429
NP_440868.1_4 Reverse -117 -129 3.48056 0.135
NP_440868.1_4 Forward -134 -122 0.923956 0.196
NP_440401.1_9 Forward -86 -79 14.5917 0.287
NP_442787.1_1 Reverse -51 -70 30.5804 0.0000729
NP_442402.1_4 Reverse -217 -236 -2.75457 0.203
NP_440653.1_8 Forward -210 -191 15.1424 0.194
NP_442039.1_4 Forward -129 -122 15.1821 0.0124
NP_442039.1_4 Reverse -122 -129 15.1821 0.0124
NP_442837.1_3 Forward -129 -122 15.7721 0.0124
NP_442837.1_3 Reverse -122 -129 15.7721 0.0124
NP_440160.1_2 Forward -55 -36 -9.34199 0.293
NP_440160.1_9 Reverse -162 -181 10.0292 0.235
NP_442053.1_1 Forward -130 -121 18.3876 0.0007
NP_442053.1_1 Reverse -121 -130 18.3876 0.0007
NP_442053.1_1 Forward -171 -162 9.63616 0.0621
NP_442053.1_1 Forward -354 -345 4.91628 0.218
NP_440505.1_3 Forward -132 -122 18.3679 0.00213
NP_440505.1_3 Reverse -119 -129 15.9097 0.00857
NP_441203.1_1 Forward -53 -34 -11.8003 0.139
NP_440914.1_1 Reverse -121 -131 17.5935 0.000537
NP_440914.1_1 Forward -130 -120 8.6151 0.186
NP_441011.1_8 Forward -129 -120 16.9127 0.00602
NP_441011.1_8 Reverse -122 -131 8.25953 0.144
NP_442101.1_10 Reverse -37 -56 -6.1954 0.183
NP_442101.1_10 Forward -138 -119 -11.0136 0.261
NP_442533.1_6 Forward -130 -121 17.2076 0.00137
NP_442533.1_6 Reverse -121 -130 17.2076 0.00137
NP_442533.1_6 Forward -274 -265 3.34298 0.216
NP_442541.1_10 Reverse -45 -59 0.883986 0.295
NP_442322.1_4 Forward -186 -169 -9.99156 0.297
NP_441482.1_7 Forward -136 -122 -2.55701 0.0968
NP_441482.1_7 Reverse -115 -129 -2.55701 0.0968
NP_441482.1_7 Forward -177 -163 -11.0135 0.229
NP_439944.1_9 Reverse -122 -132 10.5014 0.0887
NP_440116.1_8 Reverse -122 -141 -0.787193 0.113
NP_440115.1_6 Forward -133 -123 6.76487 0.167
NP_441680.1_4 Reverse -352 -371 4.916 0.199
NP_441602.1_3 Reverse -135 -154 -0.688862 0.224
NP_441602.1_3 Reverse -116 -135 -1.96717 0.231
NP_441602.1_3 Forward -135 -116 -2.26216 0.233
NP_440317.1_1 Reverse -142 -161 12.4875 0.266
NP_441972.1_5 Forward -53 -34 -4.42544 0.211
NP_441972.1_5 Forward -89 -70 -7.96535 0.256
NP_441106.1_1 Reverse -120 -129 18.191 0.0028
NP_441106.1_1 Forward -131 -122 9.63616 0.0311
NP_440429.1_2 Forward -166 -147 7.47261 0.288
NP_442588.1_6 Forward -147 -128 -2.85214 0.296
NP_441286.1_1 Forward -131 -119 6.03717 0.0258
NP_441286.1_1 Reverse -120 -132 3.38223 0.0467
NP_441286.1_1 Reverse -366 -378 -6.2542 0.254
NP_440670.1_8 Forward -130 -121 18.3876 0.000699
NP_440670.1_8 Reverse -121 -130 18.3876 0.000699
NP_440886.1_7 Reverse -120 -130 17.7774 0.0011
NP_440886.1_7 Forward -131 -121 7.94438 0.0805
NP_440886.1_10 Reverse -57 -76 7.37347 0.29
NP_442072.1_9 Forward -131 -113 -13.5505 0.115
NP_442072.1_9 Reverse -120 -138 -21.5153 0.209
NP_441753.1_10 Forward -46 -27 2.85105 0.226
NP_441069.1_5 Forward -176 -158 0.904127 0.28
NP_442022.1_4 Forward -361 -342 13.1758 0.166
NP_442022.1_4 Forward -286 -267 6.58763 0.27
NP_440907.2_8 Forward -129 -119 7.94438 0.117
NP_442264.1_4 Forward -394 -380 16.9125 0.228
NP_441626.1_2 Forward -129 -122 15.7721 0.0124
NP_441626.1_2 Reverse -122 -129 15.7721 0.0124
NP_441460.1_2 Forward -159 -146 15.6533 0.171
NP_442794.1_1 Forward -134 -122 17.1486 0.0232
NP_442794.1_1 Reverse -117 -129 7.61046 0.136
NP_442615.1_1 Reverse -112 -130 -4.70074 0.192
NP_441962.1_4 Forward -135 -116 -9.63698 0.218
NP_440387.1_1 Forward -130 -114 -0.0397962 0.134
NP_440387.1_1 Reverse -121 -137 -1.3181 0.142
NP_440855.1_9 Reverse -82 -101 17.8948 0.22
NP_441488.1_8 Forward -135 -121 7.86545 0.221
NP_441836.1_2 Reverse -115 -134 12.8808 0.0686
NP_441993.1_1 Forward -136 -117 8.28142 0.15
NP_441993.1_1 Reverse -39 -58 6.23481 0.184
NP_440467.1_3 Reverse -46 -65 10.8656 0.296
NP_442437.1_3 Reverse -123 -142 12.3883 0.174
NP_442323.1_7 Forward -197 -178 1.27698 0.285
NP_441510.2_7 Forward -197 -183 13.2736 0.28
NP_440287.1_5 Forward -192 -173 15.6332 0.158
NP_440293.1_3 Reverse -374 -393 -5.99873 0.285
NP_440766.1_4 Forward -134 -120 0.687908 0.271
NP_439988.1_3 Reverse -377 -391 6.3911 0.278
NP_441979.1_9 Forward -382 -363 2.75272 0.297
NP_442743.1_5 Reverse -29 -48 8.45592 0.148
NP_441246.1_7 Reverse -70 -89 6.78429 0.199
NP_439910.1_2 Reverse -113 -130 -3.00942 0.0318
NP_440457.1_1 Reverse -117 -129 6.33216 0.123
NP_440457.1_1 Forward -134 -122 6.33216 0.123
NP_441984.1_3 Reverse -117 -135 10.0489 0.194
NP_441436.1_8 Forward -55 -36 12.2908 0.243
NP_441436.1_8 Forward -131 -112 8.16093 0.283
NP_440473.1_9 Reverse -151 -170 -10.0303 0.269
NP_442509.1_9 Forward -130 -120 16.2041 0.00739
NP_442509.1_9 Reverse -162 -172 11.091 0.147
NP_442509.1_9 Reverse -121 -131 8.14104 0.192
NP_442514.1_5 Forward -206 -187 -7.57277 0.276
NP_440554.1_4 Forward -129 -119 16.4996 0.0189
NP_440554.1_4 Reverse -122 -132 8.92815 0.0646
NP_441885.1_5 Reverse -121 -131 20.9245 0.000538
NP_441885.1_5 Forward -130 -120 11.4848 0.00668
NP_440478.1_4 Reverse -117 -136 12.7825 0.223
NP_440478.1_4 Forward -58 -39 11.8975 0.239
NP_440478.1_10 Reverse -119 -133 16.4209 0.107
NP_442341.1_7 Forward -131 -117 12.1926 0.0467
NP_442341.1_7 Reverse -120 -134 10.521 0.0625
NP_442395.2_4 Reverse -120 -139 2.35861 0.223
NP_442395.2_4 Forward -55 -36 2.16195 0.224
NP_443000.1_7 Forward -132 -122 19.9412 0.00223
NP_443000.1_7 Reverse -119 -129 11.5831 0.0344
NP_440275.1_3 Reverse -119 -129 15.418 0.0178
NP_440275.1_3 Forward -132 -122 15.123 0.0182
NP_443046.1_9 Reverse -316 -334 3.8533 0.265
NP_441902.1_1 Forward -168 -149 11.11 0.282
NP_440679.1_10 Reverse -363 -382 -21.0434 0.29
NP_443010.1_10 Reverse -239 -256 2.67416 0.272
NP_440175.1_4 Forward -378 -359 -5.99873 0.166
NP_440149.1_8 Forward -376 -357 -8.16202 0.3
NP_440149.1_10 Forward -54 -35 -0.39387 0.203
NP_441105.1_3 Forward -141 -122 -1.27885 0.147
NP_441105.1_3 Reverse -110 -129 -1.47551 0.15
NP_441105.1_3 Forward -65 -46 -6.58872 0.236
NP_440216.1_1 Reverse -121 -135 8.94771 0.00589
NP_440216.1_1 Forward -130 -116 7.37441 0.00942
NP_440216.1_1 Forward -171 -157 -5.70361 0.135
NP_440216.1_9 Forward -35 -26 6.48957 0.289
NP_440172.1_1 Reverse -121 -131 15.0247 0.00945
NP_440172.1_1 Forward -130 -120 8.73149 0.0586
NP_440172.1_1 Reverse -367 -377 8.4365 0.0621
NP_440172.1_1 Forward -54 -44 8.4365 0.0621
NP_442015.1_10 Reverse -117 -130 12.8023 0.0365
NP_442015.1_10 Forward -134 -121 12.5073 0.0368
NP_442015.1_10 Forward -175 -162 5.32916 0.145
NP_441226.1_7 Forward -129 -122 14.4934 0.0123
NP_441226.1_7 Reverse -122 -129 14.4934 0.0123
NP_441226.1_7 Forward -197 -190 6.52862 0.253
NP_441111.1_7 Forward -129 -121 18.7023 0.00294
NP_441111.1_7 Reverse -122 -130 18.7023 0.00294
NP_441766.1_2 Forward -130 -121 17.5026 0.00297
NP_441766.1_2 Reverse -121 -130 17.5026 0.00297
NP_441766.1_9 Forward -177 -158 -2.45882 0.281
NP_442417.1_5 Forward -130 -116 10.6193 0.11
NP_442417.1_5 Reverse -121 -135 8.45605 0.158
NP_440416.1_9 Forward -377 -358 -7.86702 0.108
NP_440416.1_9 Forward -137 -118 -8.94866 0.123
NP_440416.1_9 Reverse -350 -369 -19.6667 0.276
NP_440416.1_9 Reverse -27 -46 -20.3551 0.284
NP_443052.1_9 Reverse -350 -369 5.01433 0.149
NP_443052.1_9 Reverse -356 -375 -0.787193 0.216
NP_443052.1_9 Forward -377 -358 -5.60541 0.271
NP_440072.1_5 Reverse -174 -192 4.9357 0.236
NP_442154.1_1 Reverse -175 -193 -16.6971 0.244
NP_442564.1_6 Forward -262 -243 12.5858 0.28
NP_440261.1_5 Reverse -122 -135 -2.53732 0.0924
NP_440261.1_5 Forward -129 -116 -4.40561 0.147
NP_440261.1_7 Reverse -231 -250 -0.983855 0.19
NP_440988.1_10 Forward -199 -185 8.09365 0.205
NP_440988.1_10 Forward -378 -364 7.80321 0.215
Motif Direction Start Stop Central FIMO score FIMO q-value

Expression profile

Sequences

Promoter

ACATCTGGCGGCCCAAACCAGAAGCGTCATTGCCACCGGGGGCGGAGTGGTGCTCCGACGACAAAATTGGAGTTATCTACACCATGGCCTGGTCATTTGGCTTGATGGTTCCCTGGAATTACTTTTGGCCAGGCTCCAGGGAGATGAAGCAAGACCCCTGCTCCAGGTGGAAAATCTGGAAGAACGGTTAGGAAATTTATTGGCCCAACGGCAACCCCTCTACGCCCAGGCGGATCTCCGGTTTCCCCTGCAGGCAGACCAAGATCCTCTGGCGATCGCCGGAGAATTACTGGCCACTATTCCAGGACTGCTTAAACCCCAATGCAGTGCCGAACAAAATTGACCGGGCAATGTCCCTAGGACGGCCATGGTAAGATGATTAACTAATCTTTGACCCCCT

CDS

No sequence available

Protein

No sequence available